View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2176_low_100 (Length: 239)

Name: NF2176_low_100
Description: NF2176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2176_low_100
NF2176_low_100
[»] chr6 (5 HSPs)
chr6 (19-239)||(24179170-24179390)
chr6 (19-238)||(24188977-24189196)
chr6 (46-236)||(24168737-24168927)
chr6 (49-239)||(24151907-24152097)
chr6 (46-158)||(24112700-24112812)


Alignment Details
Target: chr6 (Bit Score: 213; Significance: 1e-117; HSPs: 5)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 19 - 239
Target Start/End: Complemental strand, 24179390 - 24179170
Alignment:
19 acgttctcgtcaaggaatctcagtactgcttctccgtcttcatattgtgacggataccgatgctctggtgtaagtcggtagttgacggagacaatgacag 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24179390 acgttctcgtcaaggaatctcagtactgcttctccgtcttcatattgtgacggataccgatgctctggtgtaagtcggtagttgacggagacaatgacag 24179291  T
119 cggagatttcccggcagagtctacggcaaacagcgtcgtagaggttcgaggaaggagaaagaaaagtgtagccaccgccgtggaagaaaatgactacagg 218  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
24179290 cggagatttcccggcagagtctacggcaaacagcgtcgtagaggttcgaggaaggagaaagaaaagtgtagccaccgccgtggaagaaaatgacgacagg 24179191  T
219 aagggaggttgttttggtggc 239  Q
    ||||||||||| |||||||||    
24179190 aagggaggttgctttggtggc 24179170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 19 - 238
Target Start/End: Complemental strand, 24189196 - 24188977
Alignment:
19 acgttctcgtcaaggaatctcagtactgcttctccgtcttcatattgtgacggataccgatgctctggtgtaagtcggtagttgacggagacaatgacag 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |||||||||||||||||||||||||||||    
24189196 acgttctcgtcaaggaatctcagtactgcttctccgtcttcatattgcgacggatagcgatgctctggtgcaagtcggtagttgacggagacaatgacag 24189097  T
119 cggagatttcccggcagagtctacggcaaacagcgtcgtagaggttcgaggaaggagaaagaaaagtgtagccaccgccgtggaagaaaatgactacagg 218  Q
    ||||||||||||||||||||||||| ||||| || ||||||||||| ||||||| ||||||||||||| ||||||| ||||||||||||||||| || ||    
24189096 cggagatttcccggcagagtctacgacaaaccgcatcgtagaggtttgaggaagaagaaagaaaagtgaagccaccaccgtggaagaaaatgacgacggg 24188997  T
219 aagggaggttgttttggtgg 238  Q
    ||||||||| ||||||||||    
24188996 aagggaggtagttttggtgg 24188977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 46 - 236
Target Start/End: Complemental strand, 24168927 - 24168737
Alignment:
46 gcttctccgtcttcatattgtgacggataccgatgctctggtgtaagtcggtagttgacggagacaatgacagcggagatttcccggcagagtctacggc 145  Q
    |||||||||||||| ||||| |||||||| | |||||| ||||| || ||||||||||| |||||||  ||| |||| ||||||||||||||||||||||    
24168927 gcttctccgtcttcgtattgcgacggatagcaatgctccggtgtgaggcggtagttgacagagacaacaacaacggatatttcccggcagagtctacggc 24168828  T
146 aaacagcgtcgtagaggttcgaggaaggagaaagaaaagtgtagccaccgccgtggaagaaaatgactacaggaagggaggttgttttggt 236  Q
    ||| ||| || |||  | | ||||| ||  ||||| | ||| ||||||| ||||||||||||||||| || ||||||||||||||||||||    
24168827 aaaaagcatcatagtagatagaggaggggcaaagataggtgaagccaccaccgtggaagaaaatgacaacgggaagggaggttgttttggt 24168737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 49 - 239
Target Start/End: Complemental strand, 24152097 - 24151907
Alignment:
49 tctccgtcttcatattgtgacggataccgatgctctggtgtaagtcggtagttgacggagacaatgacagcggagatttcccggcagagtctacggcaaa 148  Q
    ||||| || |||||||| |||||||| | |||||| |||||||| ||||||||||| ||||| |  |||||| | | ||||| ||||||||||||||| |    
24152097 tctccatcatcatattgcgacggatatctatgctccggtgtaaggcggtagttgacagagacgacaacagcgaaaacttccctgcagagtctacggcata 24151998  T
149 cagcgtcgt-agaggttcgaggaaggagaaagaaaagtgtagccaccgccgtggaagaaaatgactacaggaagggaggttgttttggtggc 239  Q
     ||| |||| | || || ||||| || ||||||||| || ||||||| ||||||||| ||||||  |||||||||||||||||||| |||||    
24151997 aagcatcgtgatagatt-gaggagggggaaagaaaactgaagccaccaccgtggaagtaaatgatgacaggaagggaggttgttttagtggc 24151907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 46 - 158
Target Start/End: Complemental strand, 24112812 - 24112700
Alignment:
46 gcttctccgtcttcatattgtgacggataccgatgctctggtgtaagtcggtagttgacggagacaatgacagcggagatttcccggcagagtctacggc 145  Q
    |||||||||||||| ||||| || |||||||||||||| |||||  | ||||||||||||||||| |  |||||   ||||| |||||||| ||| ||||    
24112812 gcttctccgtcttcgtattgcgatggataccgatgctccggtgtgtgacggtagttgacggagacgacaacagcattgattttccggcagaatctccggc 24112713  T
146 aaacagcgtcgta 158  Q
    ||||||| |||||    
24112712 aaacagcatcgta 24112700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University