View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2176_low_101 (Length: 238)
Name: NF2176_low_101
Description: NF2176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2176_low_101 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 5e-80; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 48696985 - 48697188
Alignment:
| Q |
1 |
atagatcaattcatctcaaactcggaacttgattttaaataaccaattcaattcaaaataatttttatctaggatttataattttatcaactgctcacta |
100 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
48696985 |
atagatcaattcatctcaaactcagaacatgattttaaataaccaattcaattcaaaataatttttatctaggatttatacttttatcaactgctcacta |
48697084 |
T |
 |
| Q |
101 |
aacactcacttcctttccatccacctgtttcttttggtgaatgtcacttttcatttgttatattcaatttctaaactgccgaattttatttgcacttggc |
200 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48697085 |
aacacacacttcctttccatccacc----------------tgtcacttttcatttgttatattcaatttctaaactgccgaattttatttgcacttggc |
48697168 |
T |
 |
| Q |
201 |
ataggttgagttgatgggag |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
48697169 |
ataggttgagttgatgggag |
48697188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 97 - 159
Target Start/End: Original strand, 48708833 - 48708894
Alignment:
| Q |
97 |
actaaacactcacttcctttccatccacctgtttcttttggtgaatgtcacttttcatttgtt |
159 |
Q |
| |
|
||||||||| | ||| ||||||||||||| ||||||||| |||||||||| ||||||||||| |
|
|
| T |
48708833 |
actaaacacaaatttcatttccatccacct-tttcttttgttgaatgtcacatttcatttgtt |
48708894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University