View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2176_low_105 (Length: 234)

Name: NF2176_low_105
Description: NF2176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2176_low_105
NF2176_low_105
[»] chr5 (2 HSPs)
chr5 (86-121)||(19583227-19583262)
chr5 (45-121)||(19590311-19590387)


Alignment Details
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 86 - 121
Target Start/End: Original strand, 19583227 - 19583262
Alignment:
86 gtgtgtgagagcttcaattaactgactaacggtatt 121  Q
    ||||||||||||||||||||||||||||||||||||    
19583227 gtgtgtgagagcttcaattaactgactaacggtatt 19583262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 121
Target Start/End: Complemental strand, 19590387 - 19590311
Alignment:
45 atttctcaagagttcaatggtatgatcttggattagat---acagtgtgtgagagcttcaattaactgactaacggtatt 121  Q
    ||||||||||| |||||||||||   |||||||| |||   | ||||||| ||||||||||| |||||||||||||||||    
19590387 atttctcaagaattcaatggtat---cttggatttgattatatagtgtgtcagagcttcaataaactgactaacggtatt 19590311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University