View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2176_low_108 (Length: 232)
Name: NF2176_low_108
Description: NF2176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2176_low_108 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 16 - 218
Target Start/End: Original strand, 38247741 - 38247944
Alignment:
| Q |
16 |
atagatagaaaagagattattcacacacgattatttatttgaaaatgcctaaaaaaggaggaataattttggctaggaaaatcagctta-tcctatcttg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
38247741 |
atagatagaaaagagattattcacacacgattatttatttgaaaatgcctaaaaaaggaggaataattttggctaggaaaatcagcctaatcctatcttg |
38247840 |
T |
 |
| Q |
115 |
acttgtgtgaccagtgtaacattcacatctttacaatactgagcttactcttatatcttttcttaattatccaacattcaaccccatacaacatcgtaga |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38247841 |
acttgtgtgaccagtgtaacattcacatctttacaatactgagcttactcttatatcttttcttaattatccaacattcaaccccatacaacatcgtaga |
38247940 |
T |
 |
| Q |
215 |
tttt |
218 |
Q |
| |
|
|||| |
|
|
| T |
38247941 |
tttt |
38247944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University