View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2176_low_118 (Length: 210)
Name: NF2176_low_118
Description: NF2176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2176_low_118 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 75; Significance: 1e-34; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 29001995 - 29001917
Alignment:
| Q |
1 |
cctccttgctgcattttttctgtgatgggtgagtgatgaattcgtcacagaacaattcagagtctttgacataaacaac |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29001995 |
cctccttgctgcattttttctgtgatgggtgagtgatgaattcgtcacagaacaattcagagtctttgacatcaacaac |
29001917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 133 - 189
Target Start/End: Complemental strand, 29001863 - 29001807
Alignment:
| Q |
133 |
gatgtggttcattggtttggttttcttgctcaattggattggtggtagtttctaaaa |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29001863 |
gatgtggttcattggtttggttttcttgctcaattggattggtggtagtttctaaaa |
29001807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 133 - 189
Target Start/End: Complemental strand, 28962149 - 28962093
Alignment:
| Q |
133 |
gatgtggttcattggtttggttttcttgctcaattggattggtggtagtttctaaaa |
189 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
28962149 |
gatgtggttcattggtttggttttctagctcaattgggttggtggtagtttctaaaa |
28962093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University