View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2176_low_118 (Length: 210)

Name: NF2176_low_118
Description: NF2176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2176_low_118
NF2176_low_118
[»] chr6 (3 HSPs)
chr6 (1-79)||(29001917-29001995)
chr6 (133-189)||(29001807-29001863)
chr6 (133-189)||(28962093-28962149)


Alignment Details
Target: chr6 (Bit Score: 75; Significance: 1e-34; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 29001995 - 29001917
Alignment:
1 cctccttgctgcattttttctgtgatgggtgagtgatgaattcgtcacagaacaattcagagtctttgacataaacaac 79  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
29001995 cctccttgctgcattttttctgtgatgggtgagtgatgaattcgtcacagaacaattcagagtctttgacatcaacaac 29001917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 133 - 189
Target Start/End: Complemental strand, 29001863 - 29001807
Alignment:
133 gatgtggttcattggtttggttttcttgctcaattggattggtggtagtttctaaaa 189  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29001863 gatgtggttcattggtttggttttcttgctcaattggattggtggtagtttctaaaa 29001807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 133 - 189
Target Start/End: Complemental strand, 28962149 - 28962093
Alignment:
133 gatgtggttcattggtttggttttcttgctcaattggattggtggtagtttctaaaa 189  Q
    |||||||||||||||||||||||||| |||||||||| |||||||||||||||||||    
28962149 gatgtggttcattggtttggttttctagctcaattgggttggtggtagtttctaaaa 28962093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University