View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2176_low_23 (Length: 496)

Name: NF2176_low_23
Description: NF2176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2176_low_23
NF2176_low_23
[»] chr4 (1 HSPs)
chr4 (298-479)||(15842075-15842256)


Alignment Details
Target: chr4 (Bit Score: 170; Significance: 5e-91; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 170; E-Value: 5e-91
Query Start/End: Original strand, 298 - 479
Target Start/End: Original strand, 15842075 - 15842256
Alignment:
298 tgtagaattttacccgatgatcacgcataaaaagtggctttacccatgggatatgattatttttctatggaggttgttctttctacaactttcgagtcca 397  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15842075 tgtagaattttacctgatgatcacgcataaaaagtggctttacccatgggatatgattatttttctatggaggttgttctttctacaactttcgagtcca 15842174  T
398 atagtacactcatcttcagtgatcatgattgagacacaatcccctctgttgcatggtaagggcaactaactcaattggacct 479  Q
    || |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
15842175 atggtacactcatcttcagtgatcatgattgagacacaatcccctttgttgcatggtaagggcaactaactcaattggacct 15842256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University