View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2176_low_23 (Length: 496)
Name: NF2176_low_23
Description: NF2176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2176_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 5e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 5e-91
Query Start/End: Original strand, 298 - 479
Target Start/End: Original strand, 15842075 - 15842256
Alignment:
| Q |
298 |
tgtagaattttacccgatgatcacgcataaaaagtggctttacccatgggatatgattatttttctatggaggttgttctttctacaactttcgagtcca |
397 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15842075 |
tgtagaattttacctgatgatcacgcataaaaagtggctttacccatgggatatgattatttttctatggaggttgttctttctacaactttcgagtcca |
15842174 |
T |
 |
| Q |
398 |
atagtacactcatcttcagtgatcatgattgagacacaatcccctctgttgcatggtaagggcaactaactcaattggacct |
479 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
15842175 |
atggtacactcatcttcagtgatcatgattgagacacaatcccctttgttgcatggtaagggcaactaactcaattggacct |
15842256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University