View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2176_low_26 (Length: 488)
Name: NF2176_low_26
Description: NF2176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2176_low_26 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 81; Significance: 6e-38; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 81; E-Value: 6e-38
Query Start/End: Original strand, 108 - 192
Target Start/End: Complemental strand, 26448172 - 26448088
Alignment:
| Q |
108 |
gtgtgatttcttttctcattttttacccttcatcaaactgataaatgcacaagtcttttatcataaatttgtaacaattcatggt |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26448172 |
gtgtgatttcttttctcattttttacccttcatcaaactgataaatgcacaagtcttttaccataaatttgtaacaattcatggt |
26448088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 26451359 - 26451316
Alignment:
| Q |
1 |
tagtgaattattttcctaagctaaattcaaaattggtcaaattaa |
45 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
26451359 |
tagtgaattattt-cctaagctaaattccaaattggtcaaattaa |
26451316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 323 - 423
Target Start/End: Original strand, 22689998 - 22690099
Alignment:
| Q |
323 |
tcaatccaatcaccgtaaatacgattgatctt-ttgtttaatttcaaattaagaaaatgcttcctcttagcatgctcctcttccttagccacaagtagac |
421 |
Q |
| |
|
|||||||||||| | || ||| |||| |||| |||||||||||||| ||| ||| ||||| ||||||| |||||||||||||| |||||| ||||| |
|
|
| T |
22689998 |
tcaatccaatcagcatatatagtattggtcttcttgtttaatttcaaccaaagtaaacgcttcttcttagcctgctcctcttcctttgccacacctagac |
22690097 |
T |
|
| Q |
422 |
tt |
423 |
Q |
| |
|
|| |
|
|
| T |
22690098 |
tt |
22690099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 75 - 110
Target Start/End: Complemental strand, 26451279 - 26451243
Alignment:
| Q |
75 |
ttaagcataaagagatttttaggat-ataaacgggtg |
110 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
26451279 |
ttaagcataaagagatttttaggatcataaacgggtg |
26451243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 8e-16; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 323 - 417
Target Start/End: Complemental strand, 46865650 - 46865558
Alignment:
| Q |
323 |
tcaatccaatcaccgtaaatacgattgatcttttgtttaatttcaaattaagaaaatgcttcctcttagcatgctcctcttccttagccacaagt |
417 |
Q |
| |
|
|||||||||||||| |||| |||||||||||| |||||||||||| ||| |||||| || ||||||| |||||||||||||| ||||||||| |
|
|
| T |
46865650 |
tcaatccaatcaccataaacacgattgatctt--gtttaatttcaaccaaagtaaatgcatcttcttagcctgctcctcttcctttgccacaagt |
46865558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 323 - 439
Target Start/End: Complemental strand, 46901526 - 46901409
Alignment:
| Q |
323 |
tcaatccaatcaccgtaaatacgattgatctt-ttgtttaatttcaaattaagaaaatgcttcctcttagcatgctcctcttccttagccacaagtagac |
421 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||| ||| ||||||||| |||| || |||||| ||||| | |||||||| ||||| | || ||||||| |
|
|
| T |
46901526 |
tcaatccaatcaccataaataccattgatcttcttgcctaatttcaacctaagtaagtgcttcttcttatcctgctcctcatcctttgtcatgagtagac |
46901427 |
T |
|
| Q |
422 |
ttgtgggcaaggtagtag |
439 |
Q |
| |
|
||| || |||||||||| |
|
|
| T |
46901426 |
ttgcggtgaaggtagtag |
46901409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 321 - 353
Target Start/End: Complemental strand, 46874457 - 46874425
Alignment:
| Q |
321 |
cgtcaatccaatcaccgtaaatacgattgatct |
353 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
46874457 |
cgtcaatccaatcaccgtaaatacgattgatct |
46874425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 323 - 353
Target Start/End: Complemental strand, 46892277 - 46892247
Alignment:
| Q |
323 |
tcaatccaatcaccgtaaatacgattgatct |
353 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
46892277 |
tcaatccaatcaccgtaaatacgattgatct |
46892247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 204 - 272
Target Start/End: Complemental strand, 46865802 - 46865734
Alignment:
| Q |
204 |
tatgaactgatcactatcaccgatgaccatgttctcaaaattctctcaacggagaagaatccctatcca |
272 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||| ||||||||| || |||| ||||||| |||||| |
|
|
| T |
46865802 |
tatgaactgatcaccatcaccaatgaccatgtttccaaaattctgtctgtggagtagaatccttatcca |
46865734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University