View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2176_low_41 (Length: 400)
Name: NF2176_low_41
Description: NF2176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2176_low_41 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 183 - 376
Target Start/End: Complemental strand, 55629 - 55436
Alignment:
| Q |
183 |
gtaaacctagattgatggatatgatgatgttgtttgtaataaactaaaatttggctaaacccagatttcttattattgttattagttagatttaatttaa |
282 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
55629 |
gtaaacctggattgaaggatatgatgatgttgtttgtaataaattaaaatttggctaaatccaaatttcttattattgttattagttagatttaatttaa |
55530 |
T |
|
| Q |
283 |
ataaaacaaatgataagtttgataaagatgatggcgaagatgatattgaggtttatgaggttaaaggtataatgaaatgaagaagatagtgttc |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
55529 |
ataaaacaaatgataagtttgataaagatgatggcgaagatgatattgagatttatgaggttgaaggtataatgaaatgaagaagatggtgttc |
55436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 20 - 94
Target Start/End: Complemental strand, 55795 - 55721
Alignment:
| Q |
20 |
atccgaactcaaaacttgcttgagacgagaagagcaaggtggggtaatgagaaggaatatagtgaatggttgaag |
94 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55795 |
atccgaactcaaaacctgcttgagacgagaagagcaaggtggggtaatgagaaggaatatagtgaatggttgaag |
55721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University