View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2176_low_52 (Length: 381)
Name: NF2176_low_52
Description: NF2176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2176_low_52 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 137; Significance: 2e-71; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 155 - 364
Target Start/End: Complemental strand, 31586683 - 31586470
Alignment:
| Q |
155 |
ctcttcaaggtgcattgctaactctgttctctccatcaaaattaacatgagtgtctattgctcaacattgtttttactnnnnnnnnnnnnnnntcgaaaa |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31586683 |
ctcttcaaggtgcattgctaactctgttctctccatcaaaattaacatgagtgtctattgctcaacattgtttttact---ccaaaaaaaaaatcgaaaa |
31586587 |
T |
 |
| Q |
255 |
atgttcttcatcaaagcgtgcactatagca-------tcatgcaaacaaacttgaaggcaatttctcttcatttctactgcaaaaatacaaagcaataag |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31586586 |
atgttcttcatcaaagcgtgcactatagcatcatgattcatgcaaacaaacttgaaggcaatttctcttcatttctactgcaaaaatacaaagcaataag |
31586487 |
T |
 |
| Q |
348 |
aaaataaatgactattt |
364 |
Q |
| |
|
|||| |||||||||||| |
|
|
| T |
31586486 |
aaaagaaatgactattt |
31586470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 301 - 364
Target Start/End: Complemental strand, 31619445 - 31619382
Alignment:
| Q |
301 |
gaaggcaatttctcttcatttctactgcaaaaatacaaagcaataagaaaataaatgactattt |
364 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31619445 |
gaaggcaatttcccttcatttctgctgcaaaaatacaaagcaataagaaaataaatgcctattt |
31619382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University