View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2176_low_75 (Length: 304)
Name: NF2176_low_75
Description: NF2176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2176_low_75 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 8e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 18 - 209
Target Start/End: Original strand, 4570221 - 4570412
Alignment:
| Q |
18 |
ccttcctcatcttcaggtggcaatatactagcaattttgtccaaaatgtcttcaggtacccaatgattcaacaaagcccaattccatgctccattactat |
117 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4570221 |
ccttcctcatcttcaggtggcaatataatagcaattttgtccaaaatgtcttcaggtacccaatgattcaacaaagcccaattctatgctccattactat |
4570320 |
T |
 |
| Q |
118 |
ctaataaatttgaaactttagcatcacgtaaggcacttggaatggtaatattcaagtctgctactcttagaccaggtccaatccatgcacat |
209 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4570321 |
ctaataaatctgaaactttagcatcacgtaaggcacttggaatggtaatattcaagtctgctactcttagaccaggttcaatccatgcacat |
4570412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University