View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2176_low_84 (Length: 265)

Name: NF2176_low_84
Description: NF2176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2176_low_84
NF2176_low_84
[»] chr1 (1 HSPs)
chr1 (101-161)||(12282760-12282820)


Alignment Details
Target: chr1 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 101 - 161
Target Start/End: Original strand, 12282760 - 12282820
Alignment:
101 aacaaatttttggacttgatttaaccgagagctaaaccatttggtcaagatcccatgatcc 161  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||| || |||||    
12282760 aacaaatttttggacttgattttaccgagagctaaaccatttggtcaagatcgcacgatcc 12282820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University