View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2176_low_85 (Length: 261)
Name: NF2176_low_85
Description: NF2176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2176_low_85 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 23696341 - 23696584
Alignment:
| Q |
1 |
ccagctaaaaccgaaaccaaacgttgctcttcaaaacacaagagtttcatgtagtagacactcacctataaaagaaatgtagggaacactctctgaaggn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
23696341 |
ccagctaaaaccgaaaccaaacgttgctcttcaaaacacaagagtttcatgtagtagacactcacctataaaagaaatgtagtgaacactctctgaagga |
23696440 |
T |
 |
| Q |
101 |
nnnnnncattctgagggaacatggacagaacttt-tcatctcctacaacagacaatgaaactttacttgatgatttcgactctttagcccttcatgctga |
199 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23696441 |
aaaaaaaattctgagggaacatggagggaacttcatcatctcctacaacagacaatgaaactttacttgatgatttcgactctttagcccttcatgctga |
23696540 |
T |
 |
| Q |
200 |
agagatatttccattatttgacgaggaatatgcagatgaaatac |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23696541 |
agagatatttccattatttgacgaggaatatgcagatgaaatac |
23696584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University