View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2176_low_96 (Length: 248)
Name: NF2176_low_96
Description: NF2176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2176_low_96 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 75 - 236
Target Start/End: Complemental strand, 6990365 - 6990206
Alignment:
| Q |
75 |
tgaccaactttcagcacattcttgctttcaaaatttgatcaaattgactgtagatggttgcgaaagggtaagcatttcaaattgcttcatgttttctttt |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||| |||||| |||||||||| ||||||||||||||||||||||||| ||||||| || | |
|
|
| T |
6990365 |
tgaccaactttcagcacattcttgctttcaaaatttgaccaagttgactttagatggttgtgaaagggtaagcatttcaaattgctacatgttt--ttct |
6990268 |
T |
|
| Q |
175 |
gtctataattttcatagtttttctttgttagttgttggacttagggtcagttgggttgattt |
236 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||| |||||| |||||||||| ||||||| |
|
|
| T |
6990267 |
gtctataatttttctagtttttctttgttaattgttagacttaaggtcagttggattgattt |
6990206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 136 - 233
Target Start/End: Complemental strand, 3758238 - 3758141
Alignment:
| Q |
136 |
gaaagggtaagcatttcaaattgcttcatgttttcttttgtctataattttcatagtttttctttgttagttgttggacttagggtcagttgggttga |
233 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||| ||||| ||||||||| |||||||||||||||||||||| |||| |||||||||||| |||| |
|
|
| T |
3758238 |
gaaatggtaagcatttcaaattgcttcatattttcctttgtttataatttttctagtttttctttgttagttgttagactgagggtcagttggattga |
3758141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 75 - 140
Target Start/End: Complemental strand, 3758452 - 3758387
Alignment:
| Q |
75 |
tgaccaactttcagcacattcttgctttcaaaatttgatcaaattgactgtagatggttgcgaaag |
140 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||| ||| ||||||||||||||||| ||||| |
|
|
| T |
3758452 |
tgacaaactttcagcaaattcttgctttcaaaatttgaccaatttgactgtagatggttgtgaaag |
3758387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University