View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2178_low_11 (Length: 279)
Name: NF2178_low_11
Description: NF2178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2178_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 32 - 272
Target Start/End: Original strand, 7722964 - 7723194
Alignment:
| Q |
32 |
tatgctctataattttatctcctttactatatatattttgtatttgtatgtacatgtctccatttgcaattcacgacaacgtggactgcaggtgctgact |
131 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7722964 |
tatgctttataattttatctcctttactatatatattttgtatttgtatgtacatgtctccatttgcaattcacgacaacgtggactgcaggtgctgact |
7723063 |
T |
 |
| Q |
132 |
agtatttcgacattttattatcttcaaacactacaagacaacaattcactcttctctactctactctactctnnnnnnncccttcaaatcattcattttc |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
7723064 |
agtatttcgacattttattatcttcaaacactacaagacaacaattcactcttctctactctaaaaaac----------cccttcaaatcattcattttc |
7723153 |
T |
 |
| Q |
232 |
cattactctttttcacaaagaatgatgcatcgttcatctca |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7723154 |
cattactctttttcacaaagaatgatgcatcgttcatctca |
7723194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University