View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2178_low_13 (Length: 268)
Name: NF2178_low_13
Description: NF2178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2178_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 18 - 227
Target Start/End: Original strand, 35435823 - 35436031
Alignment:
| Q |
18 |
gaacggtggcggttggggaaagaggtggctcttggtagaggtgctttgtggcattttaccatttgttttagtttcctacttcttcgtagtttgaactatg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
35435823 |
gaacggtggcggttggggaaagaggtggctcttggtagaggtgctttgtggcattttaccatttgttttagtttcctacctcttcgtggtttgaactatg |
35435922 |
T |
|
| Q |
118 |
attaagatatcgacatttaataagaggatatattattgctatatatcagtgaattttannnnnnnnctacaagttttagaactttatagaagataatgta |
217 |
Q |
| |
|
||||||| ||| |||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35435923 |
attaagagatcaacatttaataagagaatatattattgctatatatcagtgaatttta-tttttttctacaagttttagaactttatagaagataatgta |
35436021 |
T |
|
| Q |
218 |
ttgtcctctt |
227 |
Q |
| |
|
|||||||||| |
|
|
| T |
35436022 |
ttgtcctctt |
35436031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University