View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2178_low_8 (Length: 319)
Name: NF2178_low_8
Description: NF2178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2178_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 85 - 300
Target Start/End: Original strand, 7127620 - 7127835
Alignment:
| Q |
85 |
gttgaaattcagggacagcgacgaagaagttgcagtggcaacaattgtagaatccacaagatcaacatcaacactgtgattttcagagaactctaattgt |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7127620 |
gttgaaattcagggacagcgacgaagaagttgcagtggctacaattgcagaatccacaagatcaacatcaacactgtgattttcagagaacactaattgt |
7127719 |
T |
|
| Q |
185 |
tcttgacacgttgtatccgacacgtgtgaaggctcgtgtgtgagattatcagggcgtgtgaagtttaactgaagtagggtccgttgtgtgagttttcgtt |
284 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7127720 |
tcttgacacgttgtatccaacacgtgtgaaggctcgtgtgtgagattatcagggcgtgtgaagtttaactgaagtagggtccgttgtgtgagttttcgtt |
7127819 |
T |
|
| Q |
285 |
tcgttccacttcgttt |
300 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
7127820 |
tcgttccacttcgttt |
7127835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University