View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2179-Insertion-11 (Length: 226)
Name: NF2179-Insertion-11
Description: NF2179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2179-Insertion-11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 8 - 131
Target Start/End: Complemental strand, 35968466 - 35968343
Alignment:
| Q |
8 |
tcggtatagatgaaattaactttggattaatcaaggtgttctaggcagatatcaaagaagatgttatgaggttcttggtggaatttcatccgaatggtaa |
107 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||||||| || |||||| |||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
35968466 |
tcggtatagatggaattaactttgaattaatcaaggtgttctgggtagatatgaaagaagatgttatgaggctcttggtggaatttcatcttaatggtaa |
35968367 |
T |
|
| Q |
108 |
ctttttgagagactctaactgtac |
131 |
Q |
| |
|
|||| ||||||||||||| ||||| |
|
|
| T |
35968366 |
ctttgtgagagactctaattgtac |
35968343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 193 - 226
Target Start/End: Complemental strand, 35968277 - 35968244
Alignment:
| Q |
193 |
cttgttgggtgcatgtataaagtgttggataagg |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
35968277 |
cttgttgggtgcatgtataaagtgttggataagg |
35968244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University