View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2179R-Insertion-10 (Length: 176)
Name: NF2179R-Insertion-10
Description: NF2179R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2179R-Insertion-10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 114; Significance: 4e-58; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 114; E-Value: 4e-58
Query Start/End: Original strand, 9 - 173
Target Start/End: Complemental strand, 19215544 - 19215363
Alignment:
| Q |
9 |
agaagttcctacacttttcacaccatagtctttgtttgagtacctctataccttcacaagttcaatatttaccaactgagtttcgatcacactcact--- |
105 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19215544 |
agaagttcctacacttttcacgccatagtctttgtttgagtacctctataccttcacaagttcaatatttaccaactgagtttcgatcacactcactcct |
19215445 |
T |
|
| Q |
106 |
--------------cctagaattgaatgccttgctctcttttctttctccttcaaacatcttctatgttcctgtttctctct |
173 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
19215444 |
acaatatttggttacctagaattgaatgccttgctctattttctttctccttcaaacatcttctatgttcctctttctctct |
19215363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 60; Significance: 7e-26; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 60; E-Value: 7e-26
Query Start/End: Original strand, 106 - 173
Target Start/End: Complemental strand, 29821741 - 29821674
Alignment:
| Q |
106 |
cctagaattgaatgccttgctctcttttctttctccttcaaacatcttctatgttcctgtttctctct |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
29821741 |
cctagaattgaatgccttgctctcttttctttctccttcaaacatcttctatgtttctctttctctct |
29821674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University