View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2179R-Insertion-11 (Length: 171)
Name: NF2179R-Insertion-11
Description: NF2179R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2179R-Insertion-11 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 2e-78; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 2e-78
Query Start/End: Original strand, 8 - 171
Target Start/End: Complemental strand, 16113380 - 16113217
Alignment:
| Q |
8 |
ataatgcactatggtttttaagttagatattatagaaataaaaaatagtagtgttaggaacattatcattttcaataggagttagaattatttgaaactc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16113380 |
ataatgcactatggtttttaagttagatattatagaaataaaaaatagtagtgttaggaacattatcattttcaataggagttagaattatttgaaactt |
16113281 |
T |
|
| Q |
108 |
ttaattttagaaacaaaatatatactgaaatatagttcagtaatggactaatggtggtccttgg |
171 |
Q |
| |
|
||||||||| ||||||||||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16113280 |
ttaattttaaaaacaaaatatgtgctgaaatatagttcagtaatggactaatggtggtccttgg |
16113217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University