View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2179R-Insertion-7 (Length: 540)
Name: NF2179R-Insertion-7
Description: NF2179R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2179R-Insertion-7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 1e-98; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 1e-98
Query Start/End: Original strand, 8 - 211
Target Start/End: Complemental strand, 6417526 - 6417323
Alignment:
| Q |
8 |
aataaacactatccaaaagtcctaatattgtgaagggccnnnnnnngagccagtacttgctctgtgatataagttaaaatagggcaagtcacgcttgttg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6417526 |
aataaacactatccaaaagtcctaatattgtgaagggcctttttttgagccagtacttgctctgtgatataagttaaaatagggcaagtcacgcttgttg |
6417427 |
T |
|
| Q |
108 |
aatagtatattcattaattagtatatcgagactttctttgggttgcaccaattgagtggcttgccagtgccacaagttcttctgctaatccttttcctta |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6417426 |
aatagtatattcattaattagtatatcgagactttctttgggttgcaccaattgagtggcttgccagtgccacaagttcttctgctaatccttttcctta |
6417327 |
T |
|
| Q |
208 |
gatt |
211 |
Q |
| |
|
|||| |
|
|
| T |
6417326 |
gatt |
6417323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 155; E-Value: 5e-82
Query Start/End: Original strand, 192 - 354
Target Start/End: Complemental strand, 6417311 - 6417149
Alignment:
| Q |
192 |
ctaatccttttccttagattaacactttgattttaacaaatccaccgtgatatcaaactcaccctgatgctatagtgacgacgggatgcaactccaccgg |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
6417311 |
ctaatccttttccttagattaacactttgattttaacaaatccaccgtgatatcaaactcacgctaatgctatagtgacgacgggatgcaactccaccgg |
6417212 |
T |
|
| Q |
292 |
agatggtgtaccaaacaatagtcgactagttaaggctaatgcgctcaagggcatgtcaatact |
354 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6417211 |
agatggtgtaccaaacaatagtcgactagttaaggctaatgcgctcaagggcatgtcaatact |
6417149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 98; E-Value: 5e-48
Query Start/End: Original strand, 355 - 456
Target Start/End: Complemental strand, 6417105 - 6417004
Alignment:
| Q |
355 |
gtgtatttctctcatgtgtgatcttaactctttattaaagaggtgagagagtgacttttaatattaaaaatggaaagagggtataattaatggccgagat |
454 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6417105 |
gtgtatttctctcatgtgtgatcttaactctttattaaagaggtgagagagtgacttttaatattaaaaatggaaagagggtataattaatggctgagat |
6417006 |
T |
|
| Q |
455 |
ca |
456 |
Q |
| |
|
|| |
|
|
| T |
6417005 |
ca |
6417004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 482 - 540
Target Start/End: Complemental strand, 6417007 - 6416949
Alignment:
| Q |
482 |
atcactggagatgatcctctcccattgtttggattgtgtttgcttcacatttctcgcgc |
540 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| ||||||| ||||||| |
|
|
| T |
6417007 |
atcactggagatgatcctctcccattgtttggattgcgtttgcctcacattcctcgcgc |
6416949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University