View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2179_high_3 (Length: 384)
Name: NF2179_high_3
Description: NF2179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2179_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 13 - 295
Target Start/End: Original strand, 38699542 - 38699820
Alignment:
| Q |
13 |
atgaaatcataagtaaactgatgtgatggaatagggtttgagcataattaagttggataggttacatacaagaagagcaaaggtccttctccaacatcga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38699542 |
atgaaatcataagtaaactgatgtgatggaatagggtttgagcataattaagttggataggttacatacaagaagagcaaaggtccttctccaacatcga |
38699641 |
T |
 |
| Q |
113 |
atgaagaaaatgttgtcatgattttttattgcattgttcagatccatcgtttattttgcaacatcaatttacaacaatcatatataacaaatttatctgt |
212 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38699642 |
ttgaagaaaatattgtcatgattttttattgcattgttcagatccatcgtttattttgcaacatcaatttacaacaatcatatataacaaatttatctgt |
38699741 |
T |
 |
| Q |
213 |
cgtccaaggaaggaggtcatagaactttcagcgtccgatgtgtgaatctaaagcatctaaactattatagaacttgcaaaatc |
295 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38699742 |
cgtcc----aaggaggtcatagaactttcagcgtccgatgtgtgaatcttaagcatctaaactattatagaacttgcaaaatc |
38699820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University