View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2179_low_12 (Length: 242)
Name: NF2179_low_12
Description: NF2179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2179_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 8570036 - 8569810
Alignment:
| Q |
1 |
gaaatttgaccttggaagagcactctatgttttgactgtctcttttctgattaaccgctctcaaagtacta-gaatatttggctatggaaatgcagaact |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8570036 |
gaaatttgaccttggaagagcactctatgttttgactgtctcttttctgattaactgctctcaaagtactaagaatatttggctatggaaatgcagaact |
8569937 |
T |
|
| Q |
100 |
ttaatttcagtttgattgcttttgttaacaaatgtcagcaacacactcctttggtgggttcatgtgaatttttaaccaatcaaaaatactatttacattt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8569936 |
ttaatttcagtttgattgcttttgttaacaaatgctagcaacacactcttttcgtgggttcatgtgaatttttaaccaatcaaaaatactatttatattt |
8569837 |
T |
|
| Q |
200 |
tattttcattatagtaatgtgacatat |
226 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
8569836 |
tattttcattatagtaatgtgacatat |
8569810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University