View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2180_high_28 (Length: 339)
Name: NF2180_high_28
Description: NF2180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2180_high_28 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 72 - 201
Target Start/End: Complemental strand, 33492721 - 33492592
Alignment:
| Q |
72 |
atttttattgatgatgtttatcgtctaagtttaaagtggcaaattattaaatttataacttgtccaacgaacgctacaaaatttatgcgattcgtttata |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33492721 |
atttttattgatgatgtttatcgtctaagtttaaagtggcaaattattaaatttataacttgtccaacgaacgctacaaaatttatgcgattagtttata |
33492622 |
T |
|
| Q |
172 |
atttttgttaagaacctgttattttagatg |
201 |
Q |
| |
|
||||||||||||||||||||| |||||||| |
|
|
| T |
33492621 |
atttttgttaagaacctgttactttagatg |
33492592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University