View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2180_high_30 (Length: 315)
Name: NF2180_high_30
Description: NF2180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2180_high_30 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 111 - 206
Target Start/End: Original strand, 1786533 - 1786627
Alignment:
| Q |
111 |
ttttaggaatagtattgaaaatctgattttgtttagaaggaatttcatgttttggggttgagaattttgtgtttcagacttacattatgatgttaa |
206 |
Q |
| |
|
|||||| ||| |||||||||||||| || ||||||| ||||||||||||||| ||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1786533 |
ttttagtaatggtattgaaaatctgtttatgtttaggaggaatttcatgttt-ggggttgggaattttgtgtttcagacttagattatgatgttaa |
1786627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 72 - 135
Target Start/End: Complemental strand, 8745258 - 8745194
Alignment:
| Q |
72 |
gaagcttttcctgttatgttaccattgaattcaaacgta-ttttaggaatagtattgaaaatctg |
135 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |||||| ||| |||||||||||||| |
|
|
| T |
8745258 |
gaagctttacctgttatgttaccattgaattcaaacgtatttttagtaatggtattgaaaatctg |
8745194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 114
Target Start/End: Complemental strand, 22626259 - 22626217
Alignment:
| Q |
72 |
gaagcttttcctgttatgttaccattgaattcaaacgtatttt |
114 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
22626259 |
gaagctttacctgttatgttatcattgaattcaaacgtatttt |
22626217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 110 - 178
Target Start/End: Original strand, 6226335 - 6226402
Alignment:
| Q |
110 |
attttaggaatagtattgaaaatctgattttgtttagaaggaatttcatgttttggggttgagaatttt |
178 |
Q |
| |
|
||||||| ||| |||||||||||||| || ||||||| |||||||||||| |||||||||| ||||||| |
|
|
| T |
6226335 |
attttagtaatggtattgaaaatctgtttatgtttaggaggaatttcatg-tttggggttgggaatttt |
6226402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University