View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2180_high_47 (Length: 239)
Name: NF2180_high_47
Description: NF2180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2180_high_47 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 46631324 - 46631552
Alignment:
| Q |
1 |
cccttaaagtgaacaatgtcagataatttcgttgtttttccaaatttatcgcca-------agggtcggccaatttagtccttcagatttgtaaattgcc |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
46631324 |
cccttaaagtgaacaatgtcagataatttcgttgtttttccaaatttatcgccacaatttaagggtcggccaatttagtccttcaaatttgtaaattgcc |
46631423 |
T |
 |
| Q |
94 |
ctactttacaatttcaaggactgaaatacttatggtttgtgaatgtgtgaatgtttctgtgacaggcaagaaaggcattgcgtgctttaagaggattggt |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46631424 |
ctactttacaatttcaaggactgaaatacttatggtttgtgaatgtgtgaatgtttctgtgacaggcaagaaaggcattgcgtgctttaagaggattggt |
46631523 |
T |
 |
| Q |
194 |
gaagttgcaggcactgataaggggtcact |
222 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
46631524 |
gaagttgcaggcactgataaggggtcact |
46631552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University