View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2180_low_33 (Length: 315)

Name: NF2180_low_33
Description: NF2180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2180_low_33
NF2180_low_33
[»] chr2 (1 HSPs)
chr2 (111-206)||(1786533-1786627)
[»] chr6 (2 HSPs)
chr6 (72-135)||(8745194-8745258)
chr6 (72-114)||(22626217-22626259)
[»] chr4 (1 HSPs)
chr4 (110-178)||(6226335-6226402)


Alignment Details
Target: chr2 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 111 - 206
Target Start/End: Original strand, 1786533 - 1786627
Alignment:
111 ttttaggaatagtattgaaaatctgattttgtttagaaggaatttcatgttttggggttgagaattttgtgtttcagacttacattatgatgttaa 206  Q
    |||||| ||| |||||||||||||| || ||||||| ||||||||||||||| ||||||| ||||||||||||||||||||| |||||||||||||    
1786533 ttttagtaatggtattgaaaatctgtttatgtttaggaggaatttcatgttt-ggggttgggaattttgtgtttcagacttagattatgatgttaa 1786627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 72 - 135
Target Start/End: Complemental strand, 8745258 - 8745194
Alignment:
72 gaagcttttcctgttatgttaccattgaattcaaacgta-ttttaggaatagtattgaaaatctg 135  Q
    |||||||| |||||||||||||||||||||||||||||| |||||| ||| ||||||||||||||    
8745258 gaagctttacctgttatgttaccattgaattcaaacgtatttttagtaatggtattgaaaatctg 8745194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 72 - 114
Target Start/End: Complemental strand, 22626259 - 22626217
Alignment:
72 gaagcttttcctgttatgttaccattgaattcaaacgtatttt 114  Q
    |||||||| |||||||||||| |||||||||||||||||||||    
22626259 gaagctttacctgttatgttatcattgaattcaaacgtatttt 22626217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 110 - 178
Target Start/End: Original strand, 6226335 - 6226402
Alignment:
110 attttaggaatagtattgaaaatctgattttgtttagaaggaatttcatgttttggggttgagaatttt 178  Q
    ||||||| ||| |||||||||||||| || ||||||| |||||||||||| |||||||||| |||||||    
6226335 attttagtaatggtattgaaaatctgtttatgtttaggaggaatttcatg-tttggggttgggaatttt 6226402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University