View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2180_low_34 (Length: 315)
Name: NF2180_low_34
Description: NF2180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2180_low_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 20 - 296
Target Start/End: Original strand, 19172362 - 19172638
Alignment:
| Q |
20 |
gaacgagcaagattggtgaagatgaaaggatggaggtcagagatccaaagaagaggcttttctaaggagttatgccagtcttggttgaggatttgagaag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19172362 |
gaacgagcaagattggtgaagatgaaaggatggaggtcagagatccaaagaagaggcttttctaaggagttatgccagtcttggttgaggatttgagaag |
19172461 |
T |
 |
| Q |
120 |
ggtctgtggttgcagctgcgtcgagggtgtggtagtaagattggaagtgttggtggatgagctcaacgtgagttgagaggagggttaaggaggcgccgga |
219 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
19172462 |
ggtctgtgattgcagctgcgtcgagggtgtggtagtaagattggaagtgttggtggatgagctcaacgtgagttgagaggagggttaaggagtcgccgga |
19172561 |
T |
 |
| Q |
220 |
gatagaacgacggagtaatgggaggtgattgttcttgagtgtgttgaaccattctgtgtagtattctttgaatggac |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19172562 |
gatagaacgacggagtaatgggaggtgattgttcttgagtgtgttgaaccattctgtgtagtattctttgaatggac |
19172638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University