View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2180_low_43 (Length: 277)

Name: NF2180_low_43
Description: NF2180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2180_low_43
NF2180_low_43
[»] chr5 (1 HSPs)
chr5 (80-277)||(16113031-16113228)


Alignment Details
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 80 - 277
Target Start/End: Original strand, 16113031 - 16113228
Alignment:
80 aaagactctttcagatgacaccaaaaaaccaagcctatgattgttatgtggctaagtggcttccatgtggaaattagaattattagggttagctgattat 179  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16113031 aaagactctttcagatgacaccaaaaaaccaagcctatgattgttatgtggctaagtggcttccatgtggaaattagaattattagggttagctgattat 16113130  T
180 aataaaataaattaatatctaaaatatactaactaattattcagtagcatgnnnnnnnggcagaataaggacagagccaacacagaccaaggaccacc 277  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||    
16113131 aataaaataaattaatatctaaaatatactaactaattattcagtagcatgtttttttggcagaataaggacagagccaacacagaccaaggaccacc 16113228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University