View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2180_low_44 (Length: 261)
Name: NF2180_low_44
Description: NF2180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2180_low_44 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 90 - 246
Target Start/End: Complemental strand, 12946525 - 12946369
Alignment:
| Q |
90 |
atcattcctcttttcctatctctcccactattgtttttcttccaaaattagaagaaaatagaaattacaattccctacaatcgcnnnnnnnacgcatcta |
189 |
Q |
| |
|
||||||| |||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12946525 |
atcattcatcttttactatctctttcactattgtttttcttccaaaattagaagaaaatagaaattacaattccctacaatcgctttttttacgcatcta |
12946426 |
T |
 |
| Q |
190 |
tacaattacaaactgtttgatcttgatcagatggtccagaaaaatagaaatcatatc |
246 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12946425 |
tacaattacagactgtttgatcttgatcagatggtccaaaaaaatagaaatcatatc |
12946369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University