View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2180_low_49 (Length: 251)
Name: NF2180_low_49
Description: NF2180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2180_low_49 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 13 - 153
Target Start/End: Complemental strand, 43399538 - 43399397
Alignment:
| Q |
13 |
atcaagatagttacccttttttatta-gtattctatgtttaatatgaatacttaatttatatatatttggataattaagaattcaattcatctaaatgag |
111 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43399538 |
atcaagatagttacccttttttattaagtattctatgtttaatatgaatacttaatttatatatatttggatagttaagaattcaattcatctaaatgag |
43399439 |
T |
|
| Q |
112 |
tatcatgataatatttttaatagataaatatacaacataatg |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43399438 |
tatcatgataatatttttaatagataaatatacaacataatg |
43399397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University