View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2180_low_51 (Length: 240)
Name: NF2180_low_51
Description: NF2180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2180_low_51 |
 | |
|
| [»] scaffold0018 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0018 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 139017 - 139239
Alignment:
| Q |
1 |
tacaatggtataaaaacttttggtcaaataaaaatagtggcataaaaactatgttaacttttttcctacattaaaagctcttccttttcttgtgaatcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
139017 |
tacaatggtataaaaacttttggtcaaataaaaatagtggtataaaaactatgttaactcttttcctacattaaaagctcttccttttcttgtgaatcta |
139116 |
T |
|
| Q |
101 |
gcaagaagagagttatttacattaacatatctcattaacggctgattgtgaagatttcagtaaaaatacattctaatagagttgggtatgattcatattt |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
139117 |
gcaagaagagagttatttacatgaacatatctcattaacggctgattgtgaagatttcagaaaaaatacattctaatagagttgggtatgattcatattt |
139216 |
T |
|
| Q |
201 |
gcttaaaaatggacatacactcg |
223 |
Q |
| |
|
| ||||||||||||||||||||| |
|
|
| T |
139217 |
gtttaaaaatggacatacactcg |
139239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University