View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2180_low_58 (Length: 229)

Name: NF2180_low_58
Description: NF2180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2180_low_58
NF2180_low_58
[»] chr5 (1 HSPs)
chr5 (16-214)||(6417328-6417526)


Alignment Details
Target: chr5 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 16 - 214
Target Start/End: Original strand, 6417328 - 6417526
Alignment:
16 aaggaaaaggattagcagaagaacttgtggcactggcaagccactcaattggtgcaacccaaagaaagtctcgatatactaattaatgaatatactattc 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6417328 aaggaaaaggattagcagaagaacttgtggcactggcaagccactcaattggtgcaacccaaagaaagtctcgatatactaattaatgaatatactattc 6417427  T
116 aacaagcgtgacttgccctattttaacttatatcacagagcaagtactggctcnnnnnnnggcccttcacaatattaggacttttggatagtgtttatt 214  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||    
6417428 aacaagcgtgacttgccctattttaacttatatcacagagcaagtactggctcaaaaaaaggcccttcacaatattaggacttttggatagtgtttatt 6417526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University