View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2180_low_61 (Length: 224)

Name: NF2180_low_61
Description: NF2180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2180_low_61
NF2180_low_61
[»] chr6 (1 HSPs)
chr6 (4-224)||(1892601-1892821)


Alignment Details
Target: chr6 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 4 - 224
Target Start/End: Complemental strand, 1892821 - 1892601
Alignment:
4 gtgagatggatataggattatgaactgaaactttttagaattatannnnnnnaagctctcatttatgaaatataaatgatgagagaattgaggaagtcaa 103  Q
    |||| ||| |||||||||||||||||||||||||||||||||| |       ||||||||||||||||||||||||||||||||||||||||| ||||||    
1892821 gtgaaatgaatataggattatgaactgaaactttttagaattaaaattttttaagctctcatttatgaaatataaatgatgagagaattgaggtagtcaa 1892722  T
104 ttttcacattctggcaaatattatgtagcaccgacgtagacacgtgtggttacatttaggttgaaaataaattgaaaatcaaaccatcaaattgaaccaa 203  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
1892721 ttttcacattctggcaaatattatgtagcaccgacgtagacacgtgtggttacatttaggttgaaaataaattgaaaaccaaaccatcaaattgaaccaa 1892622  T
204 actgaattgggactgaaagtt 224  Q
    |||||| || |||||| ||||    
1892621 actgaactgtgactgacagtt 1892601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University