View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2181_high_9 (Length: 238)

Name: NF2181_high_9
Description: NF2181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2181_high_9
NF2181_high_9
[»] chr5 (1 HSPs)
chr5 (32-227)||(24806381-24806575)


Alignment Details
Target: chr5 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 32 - 227
Target Start/End: Complemental strand, 24806575 - 24806381
Alignment:
32 aaaaaggggttgataatgttgagaaataagttgctggaaaatcaactaatagggatgttattgctaacaaattgagttgttggaaagaaaaagaaaaata 131  Q
    ||||||||||||  |||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| |||||||    
24806575 aaaaaggggttgcaaatgttgagaaatacgttgctggaaaatcaattaatagggatgttattgctaacaaattgagttattggaaagaaaaa-aaaaata 24806477  T
132 gagtttatgtttcaatggggaaaaacaagcaagtggaacttcaaattccacaaaccgtttatgtgaatgtgccaaacacttttcttaatattcttc 227  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||    
24806476 gagtttatgtttcaatggggaaaaacatgcaagtggaacttcaaattccacaaactgtttatgtgaatgtgccaaacacttttcttagtattcttc 24806381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University