View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2181_high_9 (Length: 238)
Name: NF2181_high_9
Description: NF2181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2181_high_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 32 - 227
Target Start/End: Complemental strand, 24806575 - 24806381
Alignment:
| Q |
32 |
aaaaaggggttgataatgttgagaaataagttgctggaaaatcaactaatagggatgttattgctaacaaattgagttgttggaaagaaaaagaaaaata |
131 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
24806575 |
aaaaaggggttgcaaatgttgagaaatacgttgctggaaaatcaattaatagggatgttattgctaacaaattgagttattggaaagaaaaa-aaaaata |
24806477 |
T |
|
| Q |
132 |
gagtttatgtttcaatggggaaaaacaagcaagtggaacttcaaattccacaaaccgtttatgtgaatgtgccaaacacttttcttaatattcttc |
227 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24806476 |
gagtttatgtttcaatggggaaaaacatgcaagtggaacttcaaattccacaaactgtttatgtgaatgtgccaaacacttttcttagtattcttc |
24806381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University