View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2181_low_8 (Length: 276)
Name: NF2181_low_8
Description: NF2181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2181_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 259
Target Start/End: Complemental strand, 24972731 - 24972472
Alignment:
| Q |
1 |
gtgtaaaagcaaattaaaattgtgtttgaattagcatttgacaaatgtgatgattttgaatgaatttgattttataaaactgatttaattaaatatgaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24972731 |
gtgtaaaagcaaattaaaattgtgtttgaattagcatttgacaaatgtgatgattttgaatgaatttgattttataaaactgatttaattaaatatgaat |
24972632 |
T |
 |
| Q |
101 |
tttacat-aagttatctatgtttggatattttacactataacatgtttgataaatctaacgaagagtta-ctttatttacttcttggcaaactaaggttt |
198 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
24972631 |
tttacataaagttatctatg-ttggatattttacactaaaacatgtttgataaatctaacgaagagttagatttatttacttcttggcaaactaaggttt |
24972533 |
T |
 |
| Q |
199 |
gaagataaaattaattttaattcaaagtagccaaatatccacaattttcttttcctgaaat |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24972532 |
gaagataaaattaattttaattcaaagtagccaaatatccacaattttcttttcctgaaat |
24972472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University