View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2181_low_9 (Length: 246)

Name: NF2181_low_9
Description: NF2181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2181_low_9
NF2181_low_9
[»] chr5 (1 HSPs)
chr5 (162-229)||(3533124-3533193)


Alignment Details
Target: chr5 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 162 - 229
Target Start/End: Complemental strand, 3533193 - 3533124
Alignment:
162 agcgagtgttgctttgcttatgggttgcgatgaactctcatgtgtgtgttgtcta--tgctgccaattat 229  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||    
3533193 agcgagtgttgctttgcttatgggttgcgatgaactctcatgtgtgtgttgtctacttgctgccaattat 3533124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University