View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2182_high_14 (Length: 209)
Name: NF2182_high_14
Description: NF2182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2182_high_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 114; Significance: 5e-58; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 17 - 138
Target Start/End: Original strand, 7907539 - 7907660
Alignment:
| Q |
17 |
aaagttcccaatggcaaagaccttctttttgttcgtccggacgccgtttttaaaaagaagaaaccaataaggttcttacttttaattacttcttctatta |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7907539 |
aaagttcccaatggcaaagaccttctttttgttcgtccggacgccgtttttaataagaagaaaccaataaggttcttacttttaattacttcttctatta |
7907638 |
T |
 |
| Q |
117 |
gttattatgaagcaccgacacc |
138 |
Q |
| |
|
|||||||||||||||| ||||| |
|
|
| T |
7907639 |
gttattatgaagcacccacacc |
7907660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 148 - 189
Target Start/End: Original strand, 7907699 - 7907740
Alignment:
| Q |
148 |
actgattgaatgtaaccatgtgagtgctacatatttattaca |
189 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
7907699 |
actgattgaatgtaaccatgtgggtgctacatatctattaca |
7907740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University