View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2182_high_5 (Length: 347)
Name: NF2182_high_5
Description: NF2182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2182_high_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 323; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 20 - 342
Target Start/End: Original strand, 26882094 - 26882416
Alignment:
| Q |
20 |
agtgccatgttgcaccctgtcatcttttgtctgcaaaatagttttgtttcttggttctttattagctacctcttcgcgtgtaacttgaactctcttgcat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26882094 |
agtgccatgttgcaccctgtcatcttttgtctgcaaaatagttttgtttcttggttctttattagctacctcttcgcgtgtaacttgaactctcttgcat |
26882193 |
T |
|
| Q |
120 |
atttccaaataatgacccaccatgttacaatgagcacaaaattctgataaattttcatattctaagtctaacaaaaaataaactttctctctaccaacac |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26882194 |
atttccaaataatgacccaccatgttacaatgagcacaaaattctgataaattttcatattctaagtctaacaaaaaataaactttctctctaccaacac |
26882293 |
T |
|
| Q |
220 |
tttgtaacttagggtttgggatagatccatgtcaaccaaggctctcacatattgggcaaaagtcctatcaaacataggcttatttgttatatcatctata |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26882294 |
tttgtaacttagggtttgggatagatccatgtcaaccaaggctctcacatattgggcaaaagtcctatcaaacataggcttatttgttatatcatctata |
26882393 |
T |
|
| Q |
320 |
attatgggagaacctatgctact |
342 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
26882394 |
attatgggagaacctatgctact |
26882416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University