View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2182_low_14 (Length: 217)
Name: NF2182_low_14
Description: NF2182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2182_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 19 - 199
Target Start/End: Complemental strand, 46582590 - 46582410
Alignment:
| Q |
19 |
gagagttctgagaagattgttcttcttgtctagtttcttgctgagtattgataggtgttgcaggaagtgaagtggtgctagtttcatttaccctcatagg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
46582590 |
gagagttctgagaagattgttcttcttgtctagtttcttgctgagtattgataggtgttgcaggaagtgaagtggtgctagtttcatttactctcatagg |
46582491 |
T |
 |
| Q |
119 |
tattgaatggttaattctgccatcaatacaagtagaacattttttctctgcccagctttctatatcatattggccatgacc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46582490 |
tattgaatggttaattctgccatcaatacaagtagaacattttttctctgcccagctttctatatcatattggccatgacc |
46582410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University