View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2182_low_7 (Length: 288)
Name: NF2182_low_7
Description: NF2182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2182_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 87; Significance: 1e-41; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 67 - 161
Target Start/End: Complemental strand, 2163201 - 2163107
Alignment:
| Q |
67 |
tgcagagattccaagctaagattttctagattttcgtcaaaaggattttccaaattaaaagggaatttttcccgatctcttcggccggtttatcg |
161 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2163201 |
tgcagagattccaagctaatattttctagattttcgtcaaaaggattttccaaattaaaagggaattttttccgatctcttcggccggtttatcg |
2163107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 273
Target Start/End: Complemental strand, 2163025 - 2162992
Alignment:
| Q |
240 |
tggaaatgaaggtgagtctagtctaaggtttatc |
273 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
2163025 |
tggaaatgaaggtgagtttagtctaaggtttatc |
2162992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University