View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2183_high_15 (Length: 298)
Name: NF2183_high_15
Description: NF2183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2183_high_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 128 - 278
Target Start/End: Original strand, 5509124 - 5509274
Alignment:
| Q |
128 |
tatattgcggtaaaatgcggtcgtatttgcagttgccattaatgtcgttgtcgaggtacctaaaaccattacattgtggctgcaattacgatatttgtta |
227 |
Q |
| |
|
|||||| | ||||||||||| ||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5509124 |
tatattactgtaaaatgcggctgtatttgcagttgccattaatgtcgttgtcgagatatctaaaaccattacattgtggctgcaattacgatatttgtta |
5509223 |
T |
|
| Q |
228 |
ggatatatagttagtagtgggatttgacatagtataatgttatctgttagt |
278 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
5509224 |
ggatatatagttagtactgggatttgacatagtataatgttatctgttagt |
5509274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University