View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2183_high_18 (Length: 261)
Name: NF2183_high_18
Description: NF2183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2183_high_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 9 - 244
Target Start/End: Original strand, 25413133 - 25413368
Alignment:
| Q |
9 |
caagaatatattgtgtttagctttagagaggatggatcatttgatgtagccacggacagtattgctgccaaatctgagtcttcaagtgtcgatggaaagc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
25413133 |
caagaatatattgtgtttagctttagagaggatggatcatttgatgtagacacggacagtattgctgccaaatctgagtcttcaagtgttgatggaaagc |
25413232 |
T |
 |
| Q |
109 |
gtgaaaactcaaaggcagtgagtcgaaaggtacatattatacactcattgccattaacaaaattctcaatttttcatataaattatacccctatgtcttg |
208 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25413233 |
gtgaaaactcaaaggcggtgagtcgaaaggtacatattacacactcattgccattaacaaaattctcaatttttcatataaattatacccctatgacttg |
25413332 |
T |
 |
| Q |
209 |
gctagatatcatacatactatagatgtaatcatatt |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
25413333 |
gctagatatcatacatactatagatgtaatcatatt |
25413368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University