View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2183_high_26 (Length: 225)
Name: NF2183_high_26
Description: NF2183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2183_high_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 83 - 206
Target Start/End: Complemental strand, 33751324 - 33751201
Alignment:
| Q |
83 |
ttatattcttatccttattaaaaaacaatgtactcattgaagctgaatatataaccctttaagctaaaaagacaaaatcagtgaacagaactagtattta |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33751324 |
ttatattcttatccttattaaaaaacaatgcactcattgaagctgaatatataaccctttaagctaaaaagacaaaatcagtgaacagaactagtattta |
33751225 |
T |
|
| Q |
183 |
tactataatataattcaacaaagc |
206 |
Q |
| |
|
|||||||||||||||||| ||||| |
|
|
| T |
33751224 |
tactataatataattcaataaagc |
33751201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University