View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2183_low_26 (Length: 230)
Name: NF2183_low_26
Description: NF2183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2183_low_26 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 30152590 - 30152809
Alignment:
| Q |
1 |
tgttttatggattcaaactataaagatcaaacatagatccaagtgaatatgcatctaaagaaaatatgctgattcaagaaaaggaaaatgttataaaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30152590 |
tgttttatggattcaaactataaagatcaaacatagatccaagtgaatatgcatctaaagaaaatatgctgattcaagaaaaggaaaatgttataaaatt |
30152689 |
T |
|
| Q |
101 |
ttcgaactttataatttttgccaaaaaatgagatcaaaggttgtgaaagagaatattttaaaaattcagataaacacaatgattttataggatgcaacca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30152690 |
ttcgaactttataatttttgccaaaaaatgagatcaaaggttgtgaaagagaatattttaaaaattcagataaacacaatgattttataggatgcaacca |
30152789 |
T |
|
| Q |
201 |
taactatcacaagtagaata |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
30152790 |
taactatcacaagtagaata |
30152809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 1 - 163
Target Start/End: Original strand, 40903529 - 40903710
Alignment:
| Q |
1 |
tgttttatggattcaaactataaagatcaaacatagatccaagtgaatatgcatctaaagaaaatatgctg--------------attcaag-aaaagga |
85 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || | ||||| ||||||| |
|
|
| T |
40903529 |
tgttttaatgattcaaattataaagatcaaacatagatccaagtgaatatgcatctaaagaaaatatgatgaaagacactctaaaactcaagaaaaagga |
40903628 |
T |
|
| Q |
86 |
aaatgttataaaattttcgaactttataatttttgccaaa----aaatgagatcaaaggttgtgaaagagaatattttaaaa |
163 |
Q |
| |
|
|| || |||||||||||| |||||| ||||||||| |||| ||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
40903629 |
aattgctataaaattttcaaactttttaatttttgtcaaaaaacaaatgagatcaaaggttatgaaagagaatattataaaa |
40903710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University