View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2186_high_3 (Length: 319)
Name: NF2186_high_3
Description: NF2186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2186_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 14 - 302
Target Start/End: Original strand, 47899804 - 47900091
Alignment:
| Q |
14 |
aaataattgttgctgtttaaaaaagcaataaagaatgattattatagaaattatcaacaaatgaatagtgagcaaagtgaaagaatcataattaatcatg |
113 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
47899804 |
aaataattgttgctgtttaacaaagcaataaagaatgattattatagaaattatcaacaaatgaatagtgagcaaagtgaaataatcataattaatcatg |
47899903 |
T |
 |
| Q |
114 |
aaagtataaagcattacaaagaggaatataccttgcatagtaggcagcgacggcagccaagtagacagagtgaatccatttaggggaagtgctatgaaac |
213 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47899904 |
aaagtataaagcattacaa-gaggaatataccttgcatagtaggcagcgacggcagccaagtagacagagtgaatccatttaggggaagtgctatgaaac |
47900002 |
T |
 |
| Q |
214 |
gcaaccttccataactgaacatgcttaaccatgaatttatattgaccttccatatcattcaatggccaccctgtatactccttccatac |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47900003 |
gcaaccttccataactgaacatgcttaaccatgaatttatattgaccttccatatcattcaatggccaccctgtatactccttccatac |
47900091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University