View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2186_high_4 (Length: 301)
Name: NF2186_high_4
Description: NF2186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2186_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 23 - 247
Target Start/End: Original strand, 52824713 - 52824937
Alignment:
| Q |
23 |
gggtgtacacaaaacgttgatgtagctctagtatgaatattttgtttgtttttgtgctcctctcaaccgggttgtgtacgttcttcataaatcagtgtaa |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52824713 |
gggtgtacacaaaacgttgatgtagctctagtatgaatattttgtttgtttttgtgctcctctcaaccgggttgtgtacgttcttcataaatcagtgtaa |
52824812 |
T |
 |
| Q |
123 |
aatattaaatatttctttcacattttgtaaataagatctttaattgaattaaataactcaacttgattgattaatttttgtttgcaacttgttaaaaggg |
222 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52824813 |
aatattaaatatgtctttcacattttgtaaataagatctttaattgaattaaataactcaacttgattgattaatttttgtttgcaacttgttaaaaggg |
52824912 |
T |
 |
| Q |
223 |
gtagtacgtcttgttaaatgggatt |
247 |
Q |
| |
|
||||||| |||||||||||| |||| |
|
|
| T |
52824913 |
gtagtacatcttgttaaatgagatt |
52824937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 247 - 295
Target Start/End: Original strand, 52824960 - 52825008
Alignment:
| Q |
247 |
tcgtgagaaggtttccaaacacatgtatacatcccacaattcatctcac |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
52824960 |
tcgtgagaaggtttccaaacacatgtatacatcccacaattcatatcac |
52825008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University