View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2186_low_6 (Length: 244)

Name: NF2186_low_6
Description: NF2186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2186_low_6
NF2186_low_6
[»] chr1 (1 HSPs)
chr1 (18-244)||(48245320-48245546)


Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 244
Target Start/End: Complemental strand, 48245546 - 48245320
Alignment:
18 ttttgaatatttctttttctgtttggtggtttctttttgaatattactactattaccggtgtaactgggattttcagtcaagaatttgggattattaatt 117  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48245546 ttttgaatatttctttttttgtttggtggtttctttttgaatattactactattaccggtgtaactgggattttcagtcaagaatttgggattattaatt 48245447  T
118 agaattagaaaacgtgtgaatcttgggttgtgcctctcattattgccagcttggtctttaaaatgtcaacgaaaatatcctgactagttcacaagagtga 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48245446 agaattagaaaacgtgtgaatcttgggttgtgcctctcattattgccagcttggtctttaaaatgtcaacgaaaatatcctgactagttcacaagagtga 48245347  T
218 ttcaagttttttatttcatttgttgat 244  Q
    |||||||||||||||||||||||||||    
48245346 ttcaagttttttatttcatttgttgat 48245320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University