View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2186_low_6 (Length: 244)
Name: NF2186_low_6
Description: NF2186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2186_low_6 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 244
Target Start/End: Complemental strand, 48245546 - 48245320
Alignment:
| Q |
18 |
ttttgaatatttctttttctgtttggtggtttctttttgaatattactactattaccggtgtaactgggattttcagtcaagaatttgggattattaatt |
117 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48245546 |
ttttgaatatttctttttttgtttggtggtttctttttgaatattactactattaccggtgtaactgggattttcagtcaagaatttgggattattaatt |
48245447 |
T |
 |
| Q |
118 |
agaattagaaaacgtgtgaatcttgggttgtgcctctcattattgccagcttggtctttaaaatgtcaacgaaaatatcctgactagttcacaagagtga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48245446 |
agaattagaaaacgtgtgaatcttgggttgtgcctctcattattgccagcttggtctttaaaatgtcaacgaaaatatcctgactagttcacaagagtga |
48245347 |
T |
 |
| Q |
218 |
ttcaagttttttatttcatttgttgat |
244 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
48245346 |
ttcaagttttttatttcatttgttgat |
48245320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University