View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2186_low_8 (Length: 239)
Name: NF2186_low_8
Description: NF2186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2186_low_8 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 35 - 239
Target Start/End: Original strand, 13770677 - 13770895
Alignment:
| Q |
35 |
gtctgcaaggctatataatttgatactataatggctcttcctggttccctgcaattgtctcatggcctgggactttgcaggaacctcaacagtaataaag |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13770677 |
gtctgcaaggctatataatttgatactataatggctcttcctggttccctgcaattgtctcatggcctgggactttgcaggaacctcaacagtaataaag |
13770776 |
T |
|
| Q |
135 |
atcgggtactagaaatatcttcttcagttctat--------------gttccattttgcatatttctcatttttcttaccactttatgctttgtagaggg |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13770777 |
atcgggtactagaaatatcttcttcagttctatgttctttgttcagggttccattttgcatttttctcatttttcttaccactttatgctttgtagaggg |
13770876 |
T |
|
| Q |
221 |
taaaggggagatgcaagtt |
239 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
13770877 |
taaaggggagatgcaagtt |
13770895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University