View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2187_high_3 (Length: 274)
Name: NF2187_high_3
Description: NF2187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2187_high_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 24 - 260
Target Start/End: Complemental strand, 6582759 - 6582524
Alignment:
| Q |
24 |
gcaatagacctatagcagctacttaacaacactgattatgtgaggccgatgctccacattgagtagtatgcgtctacgagatgctcagtgaagtatttaa |
123 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6582759 |
gcaatagagctatagcagctatttaacaacact-attatgtgaggccgatgctccacattgagtagtatgcgtctacgagatgctcagtgaagtatttaa |
6582661 |
T |
 |
| Q |
124 |
gtggcttaattttttctcctttgtagctagcttttagaaaagagttctccaaatgtttagatacttattagattcctttagtttcacatccacacaaaag |
223 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6582660 |
gtggcttaatttcttctcctttgtagctagcttttagaaaagagttctccaaatgtttagatacttattagattcttttagtttcacatccacacaaaag |
6582561 |
T |
 |
| Q |
224 |
taataaatggatttttatttcaacgggcattttgtat |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6582560 |
taataaatggatttttatttcaacgggcattatgtat |
6582524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University