View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2188_high_5 (Length: 383)
Name: NF2188_high_5
Description: NF2188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2188_high_5 |
 |  |
|
| [»] scaffold0114 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0114 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: scaffold0114
Description:
Target: scaffold0114; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 17 - 353
Target Start/End: Complemental strand, 5986 - 5650
Alignment:
| Q |
17 |
aggtacgtgcggtctctaaacatatgtccattcttcatgatggggataatgtcatctcggacccaattgagatagaggaccatgttgtgtcatattttca |
116 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5986 |
aggtacgtgcggtttctaaacatatgtccattcttcatgatagggataatgtcatctcggacccaattgagatagaggagcatgttgtgtcatattttca |
5887 |
T |
 |
| Q |
117 |
gtctatttttagcgttgataatgattgtggggctaataatatggtagagcaattggttccaagattggttacggaggctgagaatgatttattatgttgc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | |
|
|
| T |
5886 |
gtctatttttagcgttgataatgattgtggggctaataatatggtagagcaattggttccaagattggttacggaggctgagactgatttattatgtcgt |
5787 |
T |
 |
| Q |
217 |
ttacctgtgatgtctgaaataaagtctgcggtttttcatcttaatgatgatagtgcgccgggtccagacgggtttggtgggcatttttacaagacgtttt |
316 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| |||||||||||||||||||||||| |||| |||| |
|
|
| T |
5786 |
ttacctatgatgtctgaaataaagtctgcggtttttgatcttaatggtgatagtgcgccgggtcctgacgggtttggtgggcatttttactagacatttt |
5687 |
T |
 |
| Q |
317 |
gggacattatttttgttgatgtggtactttcggttca |
353 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||| |
|
|
| T |
5686 |
gggacattatttctgctgatgtggtactttcggttca |
5650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University